Go to part 2: http://plin9k.ucoz.com/index/0-26

CONCLUSIONS AND PERSPECTIVES

 

Stringent quality control on sequence databases is required

 

These findings may contribute to a more stringent implementation of a quality control within nucleotide databases, as well as the professional analysts of molecular artifacts and related experiments, not to mention the rational human engineering of pharmaceutical drugs and proteins. We must first tame, through its controlled use, those palindromic linkers. Then, the use of sequence quality control (to detect those molecular artifacts) can successfully be applied. Improvements can be made in the design of Affymetrix microarrays, i.e., by removing the palindromic linker from human sequences such as AA557228, AA113291, AI798671, AA864645, AA780435, W90032, AA810599, T52176, AA976510, AI380906, AA535275, AI792166, T67559, L04270, U83598, D59474, T03148, T54342, D59674, D59787, D80164, H90908, N80129, C14426, D59619, D80240, T56800, C14298, W72424, IR1056496, T69555, D80337, C14227, C14407, C14344, D80210, etcetera.

 

Possible use of palindromes and its heterotranscripts to reverse hereditary diseases

Another possibility is the use of palindromes for the attachment of two different genes (genetic modules) for the engineering of therapeutic proteins, i.e., for the engineering of antiobesity treatments that may be customized and prescribed according to the particular metabolism of each person (21).

 

Artificial vectors for gene therapy may produce heterotranscription

 

It is possible that palindromic linkers like the ones reported in this article, or using other linkers, may be produced by artificial vectors for gene therapy also. If this is the case, an unsuspected side effect for humans may result. To date, those linkers are still present in those thousands of artificial sequences submitted to the Genbank, and are an allegory of things that can be prevented in human gene therapy. This article has been written to raise the awareness to the scientific community on the presence of these thousands of artificial hetero-transcripts by current methodologies producing the sequences reported to the Genbank as well as the vectors used in gene therapy.

 

Published and submitted heterotranscripts are still awaiting its correction

 

In doing an analysis of the sequences presented as chimerical mRNAs in Table 4 of reference (22), I also found in that article the EcoR1-related palindromic linker present inside the sequence AY029161 (16), already seen. In that sequence, there is a fragment for a putative human tumor suppressor LPTL, AF418553, originated in the human chromosome 8, and linked with a fragment for phosphohistidine phosphatase PHP14, NM_014172 originated in the human chromosome 9.

 

Until the submission of this article, none of the sequences presented here had been corrected in the Genbank. Could this be because they have not been determined as artifact products to date?

 

Another sequence in reference (22) that contained the EcoR1 related palindromic linker was BC000519, identified as an artifact and has already been removed from the Genbank.

 

A possible transposon-like removal of palindromic linkers seem to have happened on other chimeras

 

Awaiting correction are thousands of sequences like the ones presented in Table 2 (7). Sequences like AF176705 for the human F-box protein FBX10 (23), and Z28355 from the atrium heart (24), are both containing fragments of the vector and of the linker. Another sequence, HTCBYB08, contains fragments of the vector only, lacking the linker. Experiments were also done with such sequences lacking any evidence of a palindromic linker, also without obtaining amplified products by RT-PCRs (unpublished results). Both of the sequences Z28355 and HTCBYB08 exhibit traces of the same cloning vector, vector from the sequence X52324 (ARBLSKM), the pBluescript SK(-) vector (25-27). A transposon-like self-removal of the palindromic linker may be one way in which many heterotranscripts appear to be lacking the linker, as in the sequence HTCBYB08. This hypothesis also needs to be experimentally evaluated. If this is the case, palindromic linkers may be used for a possible artificial reversal of mutations in vivo (28).

 

On the other hand, heterotranscripts lacking the linker, and present in Affymetrix' microarrays, may show two different expression profiles, for example, a zero expression on one side while a contrasting higher expression on the other side (data not shown). A similar pattern is present when non-expressed introns are included within Affymetrix' probes side by side with sequences expressed by the exons, as in Figure 1 from reference (2).

 

Final comment

 

The key palindrome described in this article has already been introduced in reference (2) as CTCGTGCCGAATTCGGCACGAG and it has been reported elsewhere (2, 3, 29), also.

 

ACKNOWLEDGMENTS

 

Tracy Lynn Duncan helped in preparing this review and supported me during the last two years.

 

REFERENCES

1. Li BL, Li XL, Duan ZJ, Lee O, Lin S, Ma ZM, Chang CC, Yang XY, Park JP, Mohandas TK, Noll W, Chan L & Chang TY (1999) Human Acyl-CoA:Cholesterol Acyltransferase-1 (ACAT-1) gene organization and evidence that the 4.3-kilobase ACAT-1 mRNA is produced from two different chromosomes. J. Biol. Chem. 274: 11060-11071.

2. Castro-Chavez F (2004) Microarrays, antiobesity and the liver. Ann. Hepatol. 3: 137-145. [http://www.medigraphic.com/pdfs/hepato/ah-2004/ah044c.pdf]. Accessed Oct. 1, 2005.

3. Castro-Chavez F (2004) Some Implications for the Study of Intelligent Design Derived from Molecular and Microarray Analysis. PCID 3.1.7 (serial online), November, Issue 3. [http://www.iscid.org/pcid/2004/3/1/pcid_contents_2004_3_1.php]. Accessed Oct. 1, 2005.

4. International Human Genome Sequencing Consortium (2004) Finishing the euchromatic sequence of the human genome. Nature 431: 931-45.

5. Yang L, Lee O, Chen J, Chen J, Chang CC, Zhou P, Wang ZZ, Ma HH, Sha HF, Feng JX, Wang Y, Yang XY, Wang L, Dong R, Ornvold K, Li BL & Chang TY (2004) Human acyl-coenzyme A:cholesterol acyltransferase 1 (acat1) sequences located in two different chromosomes (7 and 1) are required to produce a novel ACAT1 isoenzyme with additional sequence at the N terminus. J. Biol. Chem. 279: 46253-62.

6. Chang CC, Huh HY, Cadigan KM & Chang TY (1993) Molecular cloning and functional expression of human acyl-coenzyme A:cholesterol acyltransferase cDNA in mutant Chinese hamster ovary cells. J. Biol. Chem. 268: 20747-55.

7. Castro-Chavez F (2005) Table 2: Part 1, Part 2. This table was originally in: http://www.geocities.com/plin9k/t2.htm , now, the full table is at: http://www.reocities.com/plin9k/t2.htm

8. Castro-Chavez F, Yechoor VK, Saha P, Martinez-Botas J, Wooten E, Sharma S, O'Connell P, Taegtmeyer H & Chan L (2003) Coordinated upregulation of oxidative pathways and downregulation of lipid biosynthesis underlie obesity resistance in Perilipin knockout mice. A microarray gene expression profile. Diabetes 52: 2666-2674.

[http://diabetes.diabetesjournals.org/cgi/content/full/52/11/2666]. Accessed Oct. 1, 2005.

9. Li C & Wong WH (2001) Model-based analysis of oligonucleotide arrays: expression index computation and outlier 

detection. Proc. Natl. Acad. Sci. U.S.A. 98: 31-36. [http://biosun1.harvard.edu/complab/dchip]. Accessed Oct. 1, 2005.

10. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped BLAST and 
PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 25: 3389-3402 [http://www.ncbi.nlm.nih.gov/BLAST]. Accessed Oct. 1, 2005.

11. Castro-Chavez F (2004) El Incremento Coordinado de las Rutas Metabolicas Oxidativas y la Disminucion en la 

Biosintesis de Lipidos Caracterizan la Resistencia a la Obesidad en el Raton Artificialmente Carente de Perilipina. 

Doctoral thesis, Universidad de Guadalajara, Guadalajara, Jalisco, Mexico. 

12. Vitelli R, Chiariello M, Lattero D, Bruni CB & Bucci C (1996) Molecular cloning and expression analysis of the human 

Rab7 GTP-ase complementary deoxyribonucleic acid. Biochem. Biophys. Res. Commun. 229: 887-890.

13. Terao M, Kurosaki M, Marini M, Vanoni MA, Saltini G, Bonetto V, Bastone A, Federico C, Saccone S, Fanelli R, Salmona M & Garattini E (2001) Purification of the aldehyde oxidase homolog 1 (AOH1) protein and cloning of the AOH1 and aldehyde oxidase homolog 2 (AOH2) genes. Identification of a novel molybdo-flavoprotein gene cluster on mouse chromosome 1. J. Biol. Chem. 276: 46347-63.

14. Matsuda A, Suzuki Y, Honda G, Muramatsu S, Matsuzaki O, Nagano Y, Doi T, Shimotohno K, Harada T, Nishida E, 

Hayashi H & Sugano S (2003) Large-scale identification and characterization of human genes that activate NF-kappaB and 

MAPK signaling pathways. Oncogene 22: 3307-3318.

15. West A, Vojta PJ, Welch DR. & Weissman BE (1998) Chromosome localization and genomic structure of the KiSS-1 metastasis suppressor gene (KISS1). Genomics 54: 145- 148.

16. Zhou XZ & Lu KP (2001) The Pin2/TRF1-interacting protein PinX1 is a potent telomerase inhibitor. Cell 107: 347-359.

17. Hirama T, Takeshita S, Matsubayashi Y, Iwashiro M, Masuda T, Kuribayashi K, Yoshida Y & Yamagishi H (1991) Conserved V(D)J junctional sequence of cross-reactive cytotoxic T cell receptor idiotype and the effect of a single amino acid substitution. Eur. J. Immunol. 21: 483-488.

18. Inoue A, Takahashi KP, Kimura M, Watanabe T & Morisawa S (1996) Molecular cloning of a RNA binding protein, S1-1. Nucleic Acids Res. 24: 2990-7.

19. Savas U, Bhattacharyya KK, Christou M, Alexander DL & Jefcoate CR (1994) Mouse cytochrome P-450EF, representative of a new 1B subfamily of cytochrome P-450s. Cloning, sequence determination, and tissue expression. J Biol Chem. 269: 14905-11.

20. Zuker M. (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31: 3406-15.

21. Qi L, Shen H, Larson I, Schaefer EJ, Greenberg AS, Tregouet DA, Corella D & Ordovas JM. (2004) Gender-specific association of a perilipin gene haplotype with obesity risk in a white population. Obes. Res. 12: 1758-65.

22. Romani A, Guerra E, Trerotola M & Alberti S (2003) Detection and analysis of spliced chimeric mRNAs in sequence databanks. Nucleic Acids Res. 31, e17: 1-8.

23. Winston JT, Koepp DM, Zhu C, Elledge SJ & Harper JW (1999) A family of mammalian F-box proteins. Curr. Biol. 9: 1180-1182.

24. Auffray C, Behar G, Bois F, Bouchier C, Da Silva C, Devignes MD, Duprat S, Houlgatte R, Jumeau MN, Lamy B (1995) IMAGE: molecular integration of the analysis of the human genome and its expression. C. R. Acad. Sci. III, Sci. Vie. 318: 263-72.

25. Short JM, Fernandez JM, Sorge JA & Huse WD (1988) Lambda ZAP: a bacteriophage lambda expression vector with in vivo excision properties. Nucleic Acids Res. 16: 7583-7600.

26. Alting-Mees MA & Short JM (1989) pBluescript II: gene mapping vectors. Nucleic Acids Res. 17: 9494.

27. Alting-Mees MA, Sorge JA & Short JM (1992) pBluescriptII: multifunctional cloning and mapping vectors. Meth. Enzymol. 216: 483-495.

28. Hirschhorn R (2003) In vivo reversion to normal of inherited mutations in humans. J. Med. Genet. 40: 721-728. [http://jmg.bmjjournals.com/cgi/content/full/40/10/721] Accessed Oct. 1, 2005.

29. Castro-Chavez F (2005) Genes involucrados en la susceptibilidad a la obesidad y los genes anti-obesidad. In: Mendez-Sanchez N (Editor), OBESIDAD. Epidemiologia, Fisiopatologia y Manifestaciones Clinicas. 2^nd Ed. Manual Moderno. Mexico (in press).