Friday, 09.18.2026
My site
Site menu
Statistics

Total online: 1
Guests: 1
Users: 0
Login form

Palindromati

This work in a better quality format and with more space can be found at: http://www.reocities.com/plin9k

Fernando Castro-Chavez.

fdocc at yahoo dot com

Independent Biotechnologist.

 

ABSTRACT

 

This article describes a family of artificial heterotranscripts (RNA chimaeras) composed by thousands of Genbank sequences containing fragments or the complete EcoRI-like adapter acting as the palindrome linker ctcgtgccgaattcggcacgag, binding together two or more genes that may be produced by different chromosomes. This happens due to current methodologies producing the reported sequences, found in the Genbank, in Affymetrix microarrays, and in many published articles reporting or using those sequences that include the EcoRI-like linker inside coding regions, and/or 5'UTR or 3'UTRs mRNA sites. This EcoRI-like linker and its heterotranscripts are here deemed as experimental artifacts, characterization that can be helpful to prevent errors, both in the studies of molecular mechanisms and in the drug discovery process.

 

Key words: EcoRI, Palindrome, Perilipin, Genbank, Affymetrix, microarray, species-specific.

 

INTRODUCTION

 

It is vital in the discovery of new medical treatments to target precise molecules without having side effects for organic tissues. To accomplish this objective it is necessary a stringent quality control within molecular databases. This article describes the finding of numerous methodological artifacts reported to the Genbank. It is recommended a most carefully analysis of nucleic acid sequences for biological, medical and drug discovery purposes.

 

A single RNA binding in one-strand two different genes from two different human chromosomes (1) was the theoretical beginning for the study on heterotranscripts.

 

Here, I define heterotranscripts as chimaeras, sequences composed by fragments corresponding to two or more genes from the same or from different chromosomes.

 

I thought that such a phenomenon reported in reference (1) must have been reflected in a rational and logical combination of Intelligently Designed gene products (2, 3). As most of the vital molecules and biological pathways are present in many organisms, I initially thought that the phenomenon described in reference (1) maybe should be present in many natural sequences as a possible functional common denominator.

 

I initially supposed that the study of sequences similar or related to the one present in reference (1) maybe could be helpful for our understanding of the molecular basis to biological change.

 

Thus, this particular phenomenon was a possible prospect for the abundance of proteins exceeding their number of genes via multiple modular combinations of diverse mRNAs. Recent estimates for humans reckon above a million of proteins produced by just 20,000 to 25,000 genes (4).

 

With these considerations in mind, my initial idea was that, if reference (1) was true, then the production of those numerous proteins could have had a putative process of RNA hetero-linkage at their formation.

 

However, after five years of comparing sequences, I came to realize that those hetero-sequences using that same oligonucleotide as its common linker were just methodological artifacts.

 

The common element of these chimeras is the linker ccgaattcgg (as presented in reference 1 inside the sequence L21934 for the H. sapiens ACAT-1 enzyme). This leaves references 1, 5 and 6 (if real), as a one and unique possible species-specific phenomenon in humans (2, 3).

 

Another article on the same sequence (1), has recently been published by the same group (5). Its authors mentioned since reference (1) the similarity of that linker with the EcoRI-adapter (a tool extensively used in molecular biology research), so the door still is open to verify whether this is a methodological artifact or not (5).

 

The initial construction of that sequence demonstrates that their cDNA library was transformed in E. coli (strain MC1061) using the phagemid vector pBluescript as well as with the expression vector pcDNA. Then, they retransformed it in the same E. coli strain (6), again. However, I have recently seen that the use of similar vectors can be involved in the production of chimerical artifacts in multiple instances, like in those examples presented in Tables 1 and 2 (7).

 

A possible, however remote, explanation for reference (1) is that we are dealing with a natural process, mostly restricted to humans. Yet, whatever the final verdict may be, the fact is that the EcoRI-like linker or adapter described in (1) was the starting point for the next findings, described in this article.

 

My personal hypothesis is that heterotranscripts or chimeras including the EcoRI-related palindromic linker ctcgtgccgaattcggcacgag or its related sequences, extending themselves to at least twelve bases, are artifacts from the molecular methodologies used, mainly mediated by its host-vector interactions.

 

RESULTS AND DISCUSSION

 

The finding of a related palindrome in Affymetrix microarrays

 

The basis for this article appeared while working with antiobesity microarrays. By studying the changes of gene expression in the obesity resistant perilipin knock out mice (8, 11), with the DNA-Chip Affymetrix MG-U74A-v2, analyzed using the free educational software dChip V.1.2 (9). One particularly intriguing hetero-transcript was the nucleotide sequence AB030505, initially reported by its submitters as the Mus musculus mRNA for UBE-1c1, UBE-1c2 & UBE-1c3 (complete cds). The following paragraph describes the sequence AB030505 and the common EcoRI-like linking element present in thousands of other Genbank sequences.

 

A careful study of the nucleotide sequence AB030505 using Blast (10) led me to an element that was linking two large sections from two different genes:

 

1. The nucleotide sequence AK078792 from chromosome 10, coding for a melanoma ubiquitous mutated protein homologue (Mum1) and

2. The nucleotide sequence BC036273 from chromosome 12, coding for retinol dehydrogenase 11 (similar to Arsdr1). The linking element within the sequence AB030505 corresponded to the palindrome ctcgtgccgaattcggcacgag, composed by 22 nucleotides.

 

Here again, as in the initial report (1), two transcripts originated in two different chromosomes were linked together in one mRNA strand. Those 22 bases contain the core palindromic linker ccgaattcgg at its center, which is similar to the one initially reported by reference (1).

 

A palindrome sequence for the double helix of DNA has the same nucleotides if read from 5' to 3', which is the normal reading direction, either from the plus (+) or from the minus (-) strand. A manual and visual assessment of this palindromic linker was done. Amazingly, this linker was present in thousands of sequences reported to the Genbank.

 

In the full Table 2 (7), I present many examples of the palindrome (or related sequences) being reported as if they were present inside coding regions. The palindromic linker mentioned is frequently translated as the artificial peptide RAEFGT, absent in sequenced protein databases (10).

 

Increase in the number of palindromic sequences reported to the Genbank

 

A monthly increase was seen in the number of sequences containing the EcoRI-like linker or its derivatives inside thousands of sequences. In one recent example (14 Oct. 2005) done in Blastn (nucleotide to nucleotide alignments), selecting the non redundant (nr) nucleic acid database sequences of Genbank, a query of 44 palindrome letters was used:

 

CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG

 

With this query, I obtainined 6010 Blast Hits using the next query conditions:

 

1. 106 as the minimum expected number. Some results are presented in Table 2 (7).

2. 1000 as the number of descriptions and of alignments.

 

In the Genbank's alternate database containing expressed sequence tags (est), which are mRNAs for putative proteins, the number of sequences containing the palindromic EcoRI-adapter is also present by the thousands.

 

Additional palindromes found by using microarrays

 

Additional targets pertaining to these linkers were also found while studying the results of microarrays available online using the software tool dChip (9) coupled to the Affymetrix probes databases. Table 1 shows examples containing the palindromic linkers.

 

Affymetrix has been a successful microarray methodology, i.e., to evaluate the gene expression in humans, mice, and rats. However, both the presence of artificial heterotranscripts and/or of their own artificial linkers can lead to a misrepresentation of its real expression inside the tissues, as the area under the curve is reduced for those genetic sequences.

 

Palindromati. 2005. ISCID, IS for Complexity, Information and Design.

Table 1. The EcoRI-related palindromic linker is present both in the Genbank sequence targets and in Affymetrix microarray probes for humans, mice and rats.

 

ID/ Organism

EcoRI Affymetrix Probes from Genbank [DNA Chip]

Graphic, non-expression of EcoRI-linker

Reference

AB002533_at

 

Homo sapiens

gaattcggcacgagcacgcgtgaga,

ggcacgagcacgcgtgagacttctc

 

 

[in the Human DNA Chips HuGene-FL and in Hu6800]

 

Ribosomal protein LP2 (Qip1)


Shipp et al, Nature Med.

8, 68. 2002

AJ243503

 

(99534_at)

 

Mus musculus

ttcggcacgagctcgtgccggtcct

 

 

[in the Mouse DNA Chips MG-U74Av2 and in MG-U74A]

Adipocyte

Ghrelin


Castro-Chavez et al. Diabetes 52, 2666. 2003

AI045710

 

(rc_AI045710_at)

 

Rattus norvegicus

atgatatgtacagatccctcgtgcc,

tgatatgtacagatccctcgtgccg,

tatgtacagatccctcgtgccgcct,

tgtacagatccctcgtgccgcctcg,

gtacagatccctcgtgccgcctcgt

 

 

[in the Rat DNA Chips RG-U34B}

Disulfide Isomerase related prot. (Erp70)


Children's National Medical Center Accesed Feb. 1, 2005.

Note: The EcoRI-related palindromic linker ctcgtgccgaattcggcacgag causes the drop of microarray expression to zero demonstrating its absence in the tissues [dChip V.1.2 (9)]. Highlighted in the second column in clear blue are the portions corresponding to the palindromic linker, and in dark blue, the nucleotides exchanged to obtain the second set or "mismatch" in Affymetrix' probes (DNA-Chip).

 

The phenomenon of heterotranscription

 

Twelve bases seem to be the minimum common denominator in order for the EcoRI palindromic linker to produce artificial heterotranscripts such as the ones reported here and present in the Genbank.

 

The most common palindromic flanks for the oligonucleotide ccgaattcgg are g and c, which give us the longer oligonucleotide gccgaattcggc. Less frequent are the flanks c and g to produce the second oligonucleotide cccgaattcggg, with a similar effect on heterotranscription. This last palindromic sequence is the one that we have in reference (1). The same palindromic sequence is present in example 9 from Table 2 (Homo sapiens X93499 for the RAB7 protein), in which we have fragments for more than two genes attached together in the same strand, through the palindromic linkers ccccgaattcgggg and gcccgaattcgggc (12).


To go to part 2: http://plin9k.ucoz.com/index/palindromati_part_2/0-26

Search
Site friends
  • Create your own site
  • Copyright MyCorp © 2026
    Create a free website with uCoz