Table 2. Transcripts with traces of an EcoRI related linker ctcgtgccgaattcggcacgag * and their supposed locations according to Genbank plus realted references.
|
# |
Accession / Organism |
Gene/Protein (Gene symbol) [notes for sides of linker (L or R)] |
Linker and its Amino Acids in Genbank |
Corresponding References According to Genbank; closest related match |
|
1 |
U58090 Homo sapiens |
Cullin gene family member, Hs-cul-4A |
aattcggcacgagctcgtgccgct NSARARAA |
Cell 85, 829-839. 1996. |
|
2 |
U28831 Homo sapiens |
Protein immuno-reactive with anti-PTH polyclonal antibodies |
gcacgagctcgtgccgat ARARAD |
Proc. Assoc. Am. Physicians 107, 296-305. 1995. |
|
3 |
BC041619 Homo sapiens |
Protein KIAA0404, for IMAGE:5923662 [R: hypoth. prot. MGC16044] |
ccctcgtgccgaattcggcacgag PSCRIRHE |
Proc. Natl. Acad. Sci. U.S.A. 99, 16899-16903. 2002. |
|
4 |
AF176705 Homo sapiens |
F-box protein FBX10 (PINX1) [R: vector] |
cctcgtgccgaattc PRAEF |
Curr. Biol. 9, 1180-2. 1999. |
|
5 |
X85792 Homo sapiens |
Vpr binding protein 1 |
tcgtgccgaattcggcacgag SCRIRHE |
Benichou et al. [Unpublished]; J Biol Chem. 277, 45091-8. 2002 |
|
6 |
AF151109 Homo sapiens |
Putative BRCA1-interacting protein (BRIP1) |
ggcacgagctcgtgccgc GTSSCR |
Wang et al. BRCA1-interacting protein. [Unpublished]; Oncogene 19, 6152-8. 2000. |
|
7 |
AF146697 Homo sapiens |
FOXP1 |
aagaattcggcacgagct KNSARA |
Cancer Res. 61, 8820-8829. 2001. |
|
8 |
NM_002342 Homo sapiens |
Gene and 3' UTR for TNFR superfamily, member 3 (LTBR) |
gctcgtgccgaattc |
Genomics 16, 214-218. 1993. [Curated by NCBI] |
|
9 |
X93499 Homo sapiens |
RAB7 protein, GTP-binding [L: Dystroglycan 1. C: Rab7. R: Envelope glycoprotein] |
ccccgaattcgggg & gcccgaattcgggc |
Biochem. Biophys. Res. Commun. 229, 887-890. 1996. |
|
10 |
X82200 Homo sapiens |
Gene and mRNA for interferon-induced Staf50 |
gaattcggcacgagctc |
J. Biol. Chem. 270, 14891-14898. 1995. |
|
11 |
U31384 Homo sapiens |
mRNA for G protein gamma-11 subunit |
ggcacgagctcgtgccg |
J. Biol. Chem. 270, 21765-21771. 1995. |
|
12 |
AF379619 Homo sapiens |
Intron near AB13, precursor mRNA |
gaattcggcacgagct |
van Roy and Staes. New human gene family. [Unpublished]. |
|
13 |
AY245868 Homo sapiens |
CDS for Aldehyde oxidase-like protein (AOX2) pseudogene |
aagaattcggcacgagca LNSARA |
Wright RM. Human aldehyde oxidase. [Unpublished]. |
|
14 |
AF339764 Homo sapiens |
mRNA from Fetal liver spleen IMAGE:108721 |
gaattcggcacgagcggcacgagct |
Genomics 79, 635-656. 2002. |
|
15 |
U43527 Homo sapiens |
5'UTR for Malignant melanoma metastasis-suppressor (KiSS-1) |
(ctct)15cctcgtgccgaattcggcacgag |
J. Natl. Cancer Inst. 88, 1731-1737. 1996; Genomics 54, 145-148. 1998. |
|
16 |
AY029161 Homo sapiens |
3'UTR for PinX1 [L: LPTL. R: PHPT1] |
ctcgtgccgaattcggcac |
Cell 107, 347-359. 2001. |
|
17 |
NR_001557 Homo sapiens |
Gene Aldehyde oxidase 2 (AOX2) on Chromosome 2 |
gaattcggcacgagc |
J. Biol. Chem. 276, 46347-46363. 2001; Genome Res. 6, 807-828. 1996. |
|
18 |
AF039656 Homo sapiens |
Gene for neuronal tissue-enriched acidic protein (NAP-22) |
gaattcggcacgagctc |
Mol. Cells 8, 471-477. 1998. |
|
19 |
Z28355 Homo sapiens |
cDNA, Atrium library Human heart |
(ctct)16cgtgccgaattcggc |
C. R. Acad. Sci. III, Sci. Vie. 318, 263-272. 1995. |
|
|
|
|
|
|
|
20 |
AB030505 Mus musculus |
3'UTR for androgen-regulated homolog (Arsdr) & Mum1, and 5'UTR for Retinol dehydrogenase 11 (Rdh11) |
ctcgtgccgaattcggcacgag |
Goto and Eddy. [Direct Submission]; Diabetes 52, 2666-74. 2003. |
|
21 |
NM_178759 and BC032879 Mus musculus |
T-cell immunoglobulin and mucin domain containing 4 (Timd4) [L: Doc4. R: Hypot. Threo-rich region/Ig ctg prot] |
acctcgtgccgaattcggcacgag TSCRIRHE |
Eur. J. Immunol. 34, 494-03. 2004; Proc. Natl. Acad. Sci. U.S.A. 99, 16899-03. 2002. |
|
22 |
AJ237586 Mus musculus |
Hypothetical protein in thymocytes |
cactcgtgccgaattcggcacgag HSCRIRHE |
Immunogenetics. 50, 255-70. 1999. |
|
23 |
NM_026928 Mus musculus |
1810014F10Rik, fucose binding |
acctcgtgccgaattcggcacgaggcctcgtgccgaattcggcacgag TSCRIRHEASCRIRHE |
J. Biol. Chem. 278, 28173-28180. 2003; Biotechnol. Bioeng. 86, 136-148. 2004. |
|
24 |
AB094480 Mus musculus |
LE51 hypothetical protein |
acctcgtgccgaattcggcacgaggcctcgtgccgaattcggcacgag TSCRIRHEASCRIRHE |
Biotechnol. Bioeng. 86, 136-148. 2004. |
|
25 |
AF487346 Mus musculus |
Dscaml1 [L: Nucleoside diphosphate kinase homologue] |
ctcgtgccgaattcggcacgag TRAEFGTR |
Shimohata et al. Cloning and characterization of mouse Dscaml1 [Unpublished]. |
|
26 |
U24160 Mus musculus |
5'UTR for Dvl-2 |
gaattcggcacgagctcg |
Mech. Dev. 58, 15-26. 1996. |
|
27 |
L49502 Mus musculus |
Gene, mRNA and 5'UTR for Phosphoprotein (p150TSP) |
cgaattcggcacgagct |
J. Biol. Chem. 271, 6952-6962. 1996. |
|
28 |
AJ010792 Mus musculus |
Muc5AC protein |
gaattcggcacgagctgc EFGTSC |
Gastroenterology 118, 70-80. 2000. |
|
29 |
NM_012047 Mus musculus |
5'UTR for bromodomain containing 7 (also called Brd7, Bp75, Celtix1, Ptpn13ip) |
gaattcggcacgagct |
J. Cell. Physiol. 185, 269-279. 2000; FEBS Lett. 459, 291-298. 1999. |
|
30 |
AI607511 Mus musculus |
EST similar to Acidic ribosomal phosophoprotein |
ctcgtgccgaattcggcacgag |
Marra et al. [Unpublished]. |
|
31 |
AF466768 Mus musculus |
5'UTR for Monoclonal antibody BBK-1 light chain |
ggcacgaggcctcgtgccgaattcggcacgagg |
Lee et al. [Direct Submission]. |
|
32 |
AF071010 Mouse mammary tumor virus (MMTV) |
Putative integrase, fusion protein, insertion of proviral MMTV into mouse SH3 domain-containing protein |
ctcgtgctgaattcggcacgagga LVLNSARG |
Popken-Harris et al. MMTV in Mice. [Unpublished]; Virus Genes 23, 35-43. 2001. |
|
33 |
U35364 Rattus norvegicus |
Sly1 homologue |
tctcgtgccgaattcggcacgagc SRAEFGTS |
Gene 169, 293-294. 1996. |
|
34 |
NM_019326 Rattus norvegicus |
Gene for neurogenic differentiation 2 (Neurod2) |
gaattcggcacgagctc |
J. Neurochem. 88, 1041-1051. 2004; Biochem. Biophys. Res. Commun. 219, 526-530. 1996. |
|
35 |
D82868 Rattus norvegicus |
mRNA for bHLH protein |
gaattcggcacgagctc |
Biochem. Biophys. Res. Commun. 219, 526-530. 1996. |
|
36 |
D63834 Rattus norvegicus |
5' UTR for Monocarboxylate transporter MCT1 |
gaattcggcacgagct |
Biochem. Biophys. Res. Commun. 217, 370-377. 1995. |
|
37 |
NM_053484 & AJ131902 Rattus norvegicus |
3' UTR for Growth arrest specific 7 (Gas7) |
cgaattcggcacgagc |
Chao CC [Unpublished]; J. Neurosci. Res. 74, 248-54. 2003. |
|
38 |
NM_031626 & U14533 Rattus norvegicus |
5' UTR & 3' UTR for Nuclear receptor subfamily 1, group H, 2 (Nr1h2) |
gaattcggcacgagc & agctcgtgccgaattc |
Proc. Natl. Acad. Sci. U.S.A. 91, 10809-10813. 1994, and 92, 2096-2100. 1995. |
|
39 |
U07609 Rattus norvegicus |
5' UTR & 3' UTR for Na+-dependent inorganic phosphate cotransporter |
gaattcggcacgagc & agctcgtgccgaattc |
Proc. Natl. Acad. Sci. U.S.A. 91, 5607-5611. 1994. |
|
40 |
NM_173145 Rattus norvegicus |
5' UTR & 3' UTR for large homolog-associated protein 4 (Dlgap4) |
gaattcggcacgagc & ctcgtgccgaattc |
J. Biol. Chem. 272, 11943-11951. 1997. |
|
41 |
NM_134335 Rattus norvegicus |
5' UTR & 3' UTR for Myosin IXA (Myo9a) |
gaattcggcacgag & ctcgtgccgaattcg |
Baehler M. Protein Myr 7. [Unpublished]. |
|
42 |
NM_053770 Rattus norvegicus |
5' UTR & 3' UTR for Arg/Abl-interacting protein ArgBP2 |
gaattcggcacgag & cgtgccgaattc |
J. Biol. Chem. 274, 30914-30918. 1999. |
|
43 |
X57710 & D00853 Oryctolagus cuniculus |
MRNA for alpha-1-antiproteinase F |
cggcacgagctcgtgcc |
J. Biochem. 109, 158-162. 1991. |
|
44 |
AY141975 Papio hamadryas |
5'UTR for Epididymal protease inhibitor 2 (Eppin) |
gcacgagctcgtgccg |
Sivashanmugam et al. Baboon. [Unpublished]. |
|
45 |
AF147784 Canis familiaris |
Retinal-specific clusterin-like preprotein (Clul1) [L:Kiaa1191] |
actcgtgccgaattcggcacgagc TRAEFGTS |
Gene. 243, 151-160. 2000. |
|
46 |
NM_001003025 Canis familiaris |
Gene and mRNA for ID3 protein |
gaattcggcacgagct |
Exp. Cell Res. 279, 62-70. 2002. |
|
47 |
AB099113 Bos taurus |
5'UTR for mitochondrial RNA, similar to 12S rRNA |
ctcgtgccgaattcggcacgag |
Mol. Reprod. Dev. 65, 9-18. 2003. |
|
48 |
U83919 Bos taurus |
mRNA for Neurofilament L subunit |
gaattcggcacgagctc |
Hill et al. [Unpublished]; J Mol. Neurosci. 20, 223-32. 2003. |
|
49 |
L81157 Equus caballus |
Immunoglobulin mu (IgM), VDJC region |
gaattcggcacgagctca EFGTSS |
Immunogenetics 45, 386-393. 1997. |
|
50 |
L81159 Equus caballus |
Immunoglobulin mu (IgM), VDJC region |
aggaattcggcacgagag RNSARE |
Immunogenetics 45, 386-393. 1997. |
|
51 |
AF506976 Equus caballus |
3' UTR for Capping protein |
ttcggcacgagctcgtgccg |
Takafuji et al. [Unpublished]; Am J Vet Res. 63, 551-8. 2002. |
|
52 |
L27860 Equus caballus |
T-cell receptor DNA, V region |
tcgaattcggcacgagca SNSARA |
Immunogenetics 40, 135-144. 1994. |
|
53 |
NM_214016 & AF384216 Sus scrofa |
Gene for CECR1 protein |
gaattcggcacgagctc |
Gene 280, 27-36. 2001. |
|
54 |
L43124 Sus scrofa |
5'UTR for vascular cell adhesion molecule (VCAM) |
gaattcggcacgagct |
Biochem. Biophys. Res. Commun. 201, 805-812. 1994; Transplantation 60, 1299-1306. 1995. |
|
55 |
NM_214078 & AF163766 Sus scrofa |
3'UTR for P-selectin (SELP) |
gctcgtgccgaattc |
J. Immunol. 164, 3309-3315. 2000. |
|
56 |
AF049746 Monodelphis domestica |
Gene for Ig lambda light chain |
ggcacgagctcgtgccg |
J. Immunol. 161, 6724-6732. 1998. |
|
57 |
AF010497 Monodelphis domestica |
5'UTR & 3'UTR for MHC class II beta chain precursor (Modo-DAB1) |
aattcggcacgagct & agctcgtgccgaattc |
Immunogenetics 49, 461-463. 1999. |
|
58 |
AJ291982 Platichthys flesus |
5'UTR for 40S Ribosomal protein S15a (Rps15a) |
gaattcggcacgagc |
Aquat. Toxicol. 65, 141-157. 2003. |
|
59 |
NM_204873 & AJ012287 Gallus gallus |
3'UTR for Alpha tectorin (LOC395686) |
agctcgtgccgaattc |
Hear. Res. 130 (1-2), 62-74. 1999. |
|
60 |
NM_204412 & U01339 Gallus gallus |
5'UTR & 3'UTR for Achaete-scute complex-like 1 (ASCL1) |
gaattcggcacgagc & ctcgtgccgaattc |
Mol. Cell. Neurosci. 25, 374-382. 2004; Development 120, 769-783. 1994. |
|
61 |
AY775183 & AY727528 Pimephales promelas |
3' UTR for Estrogen receptor alpha |
ctcgtgccgaattcg |
Filby & Tyler. Fathead Minnow. [Unpublished]; Environ. Sci. Technol.. 38, 6314-21. 2004. |
|
62 |
AF179870 Rana pipiens |
Guanylate cyclase type 2 (Gc2) |
ctcgctcgtgccgaattcggcacgaga LARAEFGTR |
Mol. Cell. Biochem. 254, 9-19. 2003. |
|
63 |
AB178055 Rana japonica |
5'UTR for Gonadotropin alpha-subunit (GTH alpha) |
aattcggcacgaggcctcgtgccgaattcggcacgagg |
Nakano et al. Gonadotropin subunit in Frog Pituitary Gland. [Unpublished]. |
|
64 |
AB072909 Xenopus laevis |
5'UTR for Claudin4L2 |
ctcgtgccgaattcggcacga |
Gene Expr. Patterns 2, 23-26. 2002. |
|
65 |
AJ243595 Xenopus laevis |
5'UTR for homeodomain transcription factor XPitx2B |
ccgaattcggcacgagctcg |
Mech. Dev. 90, 41-51. 2000. |
|
66 |
AF115498 Xenopus laevis |
Smad1 antagonistic effector (Sane)[R:Man1] |
ctcgtgccgaattcggcacgaggt LVPNSARG |
J. Biol. Chem. 278, 428-437. 2003. |
|
67 |
AF069737 Xenopus laevis |
Gene for notchless (Nle), a Notch activity modulator |
gaattcggcacgagctc |
EMBO J. 17, 7351-7360. 1998. |
|
68 |
AF419156 Xenopus laevis |
Map kinase-interacting kinase |
cgaattcggcacgag RIRHE |
Curr. Biol. 12, 105-114. 2002. |
|
69 |
AF419153 Xenopus laevis |
Mitotic phosphoprotein 67 [L: Map kinase-interacting kinase] |
ttcgaattcggcacgagg FEFGTR |
Curr. Biol. 12, 105-114. 2002. |
|
70 |
AF419149 Xenopus laevis |
Mitotic phosphoprotein 22 |
ttcgaattcggcacgagt FEFGTS |
Curr. Biol. 12, 105-114. 2002. |
|
71 |
AJ249625 Paracentrotus lividus |
Gene for for Chaperonin (Hsp60) |
gaattcggcacgagctc |
Cell Stress Chaperones 5, 87-89. 2000. |
|
72 |
AY027936 Salmo salar |
Hyperosmotic protein 21 (P21) [R: ring-box 1, Rbx1] |
ctcgtgccgaattcggcacgagcg LVPNSARA |
Am. J. Physiol. Regul. Integr. Comp. Physiol. 282, R1643-53. 2002. |
|
73 |
AY190729 Pagrus major |
Ribosomal protein L10a |
gcacgaggctcgtgccgaattcggcacgag ARGSCRIRHE |
Aquaculture 240, 115-130. 2004. |
|
74 |
NM_199765 Danio rerio |
PHD finger protein 6 (phf6). |
tctcgtgccgaattcggg SRAEFG |
Proc. Natl. Acad. Sci. U.S.A. 99, 16899-16903. 2002. |
|
75 |
BC044163 Danio rerio |
Similar to RIKEN cDNA 4931428F02 |
tctcgtgccgaattcggg SRAEFG |
Proc. Natl. Acad. Sci. U.S.A. 99, 16899-16903. 2002. |
|
76 |
AJ431209 Carassius auratus |
5'UTR [& CDS] for Proopiomelanocortin (Pomc) |
gaattcggcacgagc [& cctcggcacgagctc PRHEL, base changes] |
Regul. Pept. 115, 101-113. 2003. |
|
77 |
AF013800 Salvelinus alpinus |
5'UTR for Metallothionein A (MT A) |
gaattcggcacgagct |
Mar. Environ. Res. 46 (1-5), 551-554. 1998. |
|
78 |
AY713401 Crassostrea gigas |
Calmodulin, calcium-dependent protein kinase |
cctcgtgccgaattcggcacgagg PRAEFGTR |
Huvet et al. ESTs. [Unpubl.]; Gene 343, 211-20, 2004. |
|
79 |
AY026258 Biomphalaria glabrata |
Thioredoxin peroxidase BgTPx |
aattcggcacgagca NSARA |
Cousi n et al. [Unpubl.]; Mol Biochem Parasitol. 126, 181-91. 2003. |
|
80 |
AY069220 Drosophila melanogaster |
Gutfeeling (Guf, GH26763), Longest ORF [R: Ornithine decarboxylase antizyme] |
gctcgtgccgaattcggcacgaga ARAEFGTR |
Stapleton et al. [Direct Submission ] Genome Biol. 3, RESEARCH0080. 2002; Genome Res. 12, 1294-300. 2002. |
|
81 |
U48394 Drosophila melanogaster |
Gene for ribosomal protein S5 homolog (M(1)15D) |
gaattcggcacgagct |
Genet ics 144, 215-228. 1996. |
|
82 |
AF242203 Drosophila melanogaster |
5'UTR for Pins protein (Pins) |
gaattcggcacgagc |
Curr. Biol. 10, 353-362. 2000. |
|
83 |
AF005852 Drosophila yakuba |
Gene for Anon1G5 |
cgaattcggcacgagct |
Proc. Natl. Acad. Sci. U.S.A. 94, 9746-9750. 1997. |
|
84 |
AY295775 Depressaria pastinacella |
Cytochrome P450 (CYP9A7) |
atcgaattcggcacgagg IEFGTR |
Insect Mol. Biol. 13, 603-613. 2004. |
|
85 |
XM_312915 Anopheles gambiae |
ENSANGP00000014770 (ENSANGG00000012281) |
tacgtgccgaattcggcc YVPNSA [ base changes] |
The Anopheles Genome Sequencing Consortium |
|
86 |
AB180424 & AB180425 Plutella xylostella |
5'UTR for Ribosomal proteins L21 & S28 |
ggcacgaggcctcgtgccgaattcggcacgagg |
Eum et al. EST Analysis of moth. [Direct Submission] |
|
87 |
AF014463 Phoneutria nigriventer |
Gene & mRNA for Neurotoxic protein (Pn2-5A) |
ctcgtgccgaattcgg |
Toxicon. 36,1843-50. 1998. |
|
88 |
AF026060 Chironomus tentans |
Telomeric region |
gaattcggcacgagctc |
Kamnert et al. [Direct Submission]; Insect Mol. Biol. 11, 167-74. 2002; J. Mol. Evol. 46, 562-70. 1998. |
|
89 |
Y11879 Arenicola marina |
Trypsin-like protease |
cgtgccgaattcggcacgagt RAEFGTS |
Eberhardt and Peterson. [Direct Submission]. |
|
90 |
Y08489 Schistosoma mansoni |
Serine-rich protein |
gaattcggcacgagcttt EFGTSF |
Schuessler P. Molecules in the male-female interaction of S.mansoni. [Unpublished]. |
|
91 |
AY223273 Schistosoma japonicum |
hypothetical protein UBX domain |
cctcgtgccgaattcggcacgagg PRAEFGTR |
Nat. Genet. 35, 139-147. 2003. |
|
92 |
AB104619 Polyplastron multivesiculatum |
Cellulase (celA) |
gcacgagctcgtgccgaattcggcacgagg ARARAEFGTR |
Takenaka et al. Fibrolytic enzyme cDNA from rumen ciliates. [Unpublished]. |
|
93 |
AY029595 Schizophyllum commune |
Putative beta-glucan synthesis-associated protein (bgs1) |
gcacgagctcgtgccgaattcggcacgag ARARAEFGTS |
Guettler et al. Bgs1 gene. [Unpublished]; Fungal Genet Biol. 39, 191-8. 2003. |
|
94 |
AJ005572 Plasmodium falciparum |
Hypothetical protein [R: karyopherin beta (KP1)] |
acgagctcgtgccgaattcggcacgag TSSCRIRHE |
Shams-Eldin et al. [Unpublished] |
|
95 |
S79293 & D16136 Dirofilaria immitis |
Filarial common antigen [R: Cloning Vector, i.e., pUC & Phage f1 deriv.] |
gctcgtgccgaattc ARAEF |
Chin. Med. J. 108, 466-468. 1995. |
|
96 |
AB002777 Entamoeba histolytica |
5'UTR for ribosomal protein S29 |
ctcgtgccgaattcggcacgag |
Biochem. Biophys. Res. Commun. 236, 611-615. 1997. |
|
97 |
AB002794 and AB002739 Entamoeba histolytica |
Small subunit rRNA |
ctcgtgccgaattcggcacgag |
Biochem. Biophys. Res. Commun. 236, 611-615. 1997. |
|
98 |
AB002728 Entamoeba histolytica |
Elongation factor 1 alpha (Ef1A) |
cctcgtgccgaattcggcacgagg PRAEFGTR |
Biochem. Biophys. Res. Commun. 236, 611-15. 1997. |
|
99 |
AB002741 Entamoeba histolytica |
Amoebapore C homologue |
ctcgtgccgaattcggcacgag SCRIRHE |
Biochem. Biophys. Res. Commun. 236, 611-15. 1997. |
|
100 |
AB002731 Entamoeba histolytica |
Histone H1 |
ctcgtgccgaattcggctcgaggc LVPNSARG |
Biochem. Biophys. Res. Commun. 236, 611-15. 1997. |
|
101 |
AJ496453 Laminaria digitata |
Mannuronan C-5-epimerase (Epi) |
gaattcggcacgagc EFGTS |
Plant Physiol. 133, 726-735. 2003. |
|
102 |
AF273835 Caenorhabditis elegans |
Nuclear receptor NHR-91 |
ctcgtgccgaattcggcacgag SCRIRHE |
Robinson-Rechavi et al. HNF4 in nematodes. [Unpublished] |
|
103 |
X68492 , L03711 & L04287 Caenorhabditis elegans |
Gene and mRNA for Rac1 homologue, a small ras-related protein |
gaattcggcacgagcttgtgc |
J. Biol. Chem. 268, 320-324. 1993. |
|
104 |
AB047581 Hydra vulgaris |
Gene, mRNA & 5' UTR for homologue CnDMC1 |
gagctcgtgccgaatt |
Mochizuki & Fujisawa. [Direct Submission]. |
|
105 |
L22612 Hydra vulgaris |
5' UTR & 3' UTR for tyrosine kinase receptor |
gaattcggcacgagct & gctcgtgccgaattc |
J. Biol. Chem. 275, 10323-10330. 2000. |
|
106 |
AF306544 Hydra vulgaris |
3' UTR for Serum response factor (SRF) |
gctcgtgccgaattc |
Dev. Biol. 236, 304-315 2001. |
|
107 |
AJ250043 Anisakis simplex |
Hypothetical protein |
cggcacgagctcgtgccgaattcggcacgagga RHELVPNSARG |
Arrieta et al. Anisakis simplex for a 12 kD protein. [Unpublished] |
|
108 |
AY057457 Stizostedion vitreum |
Major histocompatibility class I receptor |
cctcgtgccgaattcggcacgagg PRAEFGTR |
Immunogenetics. 53, 760-769. 2001. |
|
109 |
Y15794 Theileria annulata |
...