Go to first part: http://plin9k.ucoz.com

Table 2. Transcripts with traces of an EcoRI related linker and some related references.

#

Accession/Organism

Gene/Protein *

Linker **

References ***

Homo sapiens

Hs-cul-4A

Homo sapiens

PSCRIRHE

Proc. Natl. Acad. Sci. U.S.A. 

99, 16899-16903. 2002.

AF176705 

Homo sapiens

F-box protein FBX10 (PINX1) 

[R: vector]

cctcgtgccgaattc

PRAEF

Curr. Biol. 9, 1180-2. 1999.

5

6

Notes: This table presents the EcoRI related linker ctcgtgccgaattcggcacgag as it appears in the Genbank for some human genes. To view the rest of this Table 2 and the presence of the linker in other organisms, refer to URL: 

* Gene/Protein (Gene symbol) [notes for sides of linker (L or R)]

** Linker and its Translation in Amino Acids as presented in the Genbank

*** Corresponding References According to the Genbank; closest related match

Abundance of sequences including the EcoRI-like palindromic linker

 There are thousands of sequences, including expressed sequence tags (est) in the Genbank and in other nucleotide databases that still contain artifacts, having as its common denominators, EcoRI palindromic linkers like the ones described in this article.

 The palindromic linkers can be present in tandems, halves, or in different lengths; being 12 to 24 bases its most common range. Artificial linkers have been found even inside multiple coding regions, like the examples presented in the full Table 2 (7). Examples of those linkers are frequently present outside the coding region, i.e, in promoters, like in:

 1-) NR_001557 for H. sapiens aldehyde oxidase 2 (AOH2) on chromosome 2, oligo gaattcggcacgagc (13).

2-) NM_002342 H. sapiens lymphotoxin beta-receptor (LTBR; member 3 of the TNFR superfamily), oligo gctcgtgccgaattc (14).

 Furthermore, those palindromic linkers have been found also in the 5' region, i.e., in sequence U43527 for the human malignant melanoma metastasis-suppressor KiSS-1, oligo (ctct)¹⁵cctcgtgccgaattcggcacgag (15), and/or in the 3' region, i.e., sequence AY029161 for the Pin2-interacting protein X1, oligo ctcgtgccgaattcggcac (16).

 Of the few submissions to the Genbank that are explicitly reporting the presence of the EcoRI adapter, Hirama et al (17) stands out, together with Inoue et al (18) and Savas et al (19). However, Inoue et al (18) considers only the 8 first bases at the left flank as part of the sequence for the EcoRI-adapter. The effect of the palindromic linker for Inoue's sequence may extend to at lest 16 bases (sequence D83948 for S1-1 protein, oligo ggcacgagctcgtgccg) by an apparent phenomenon of self-recombination and self-insertion inside the host-vector interactions.

 A similar situation to what we see in Inoue's is presented by Savas et al (19), mentioning in their Genbank submission the first 6 bases only as part of the EcoRI-adapter (same in reference 1, but not in the submitted sequence L21934). In Savas' reference (19) the linker-like effect may be extended about 20 bases (sequence X78445 for Cytochrome P450 Cyp1-b-1, oligo gaattcggcacgaactcgtgc). Hirama et al (17) is the only one that appropriately mentions a longer extension for the EcoRI-adapter, reporting it as being of 14 bases (sequence X56703 for the rearranged T-cell receptor alpha chain, oligo gaattcggcacgagct).

 Chimaeras linked by the EcoRI-like palindrome seem to be resistant to enzymatic digestion

 The palindromic linkers persist in the sequences without being digested by the enzymes. The discovery of mechanisms of resistance to the enzymatic digestion awaits further study. However, it is evident that the most common palindromic linkers match the identity of the EcoRI adapter sequence gaattcggcacgag, which is used for the 5'UTR, and reported to the Genbank, i.e., inside the sequence AI607511 as ctcgtgccgaattcggcacgag (similar to acidic ribosomal phosphoprotein PO). In that sequence, it is indicated the use of the vector pBluescript SK(-), plus EcoRI, with the additional use of the vector Uni-ZAP XR. These methodologies, like the ones described in (1, 5, 6), may be promoting the phenomenon of artificial linkage abundantly present in the Genbank.

 The rearrangement and splicing in a host-vector interaction resistant to EcoRI enzymatic digestion may be explained by a phenomenon of self-hybridization performed by the linker (Figure 3), which could make it to appear as an appendage impossible to be grasped by the digestive enzyme.

Figure 3. Self-hybridization of the palindromic EcoRI-like linker seems to block enzymatic digestion. Phenomenon also seen as 'a closing zipper', at both ends of longer sequences, where two distant parts of the linker approach and stick together producing a plasmid-like formation. [Examples 38-42, full Table 2 (7). Figure obtained using the software from reference 20.]

Go to part 3: http://plin9k.ucoz.com/index/0-27