|
109 |
Y15794 Theileria annulata |
Spm1 protein |
actcgtgccgaattcggcacgagg TRAEFGTR |
Mol. Biochem. Parasitol. 100, 135-140. 1999. |
|
110 |
AF332963 Polytomella sp. |
5'UTR for Ferrochelatase |
cctcgtgccgaattcggcacgaggcctcgtgccgaattcggcacgagg |
Atteia et al. [Unpublished]. |
|
111 |
AJ416378 Polytomella sp. |
5'UTR for Cyc |
ggcacgaggcctcgtgccgaattcggcacgaggga |
Atteia A. [Unpublished]. |
|
112 |
AY093683 Suaeda maritima |
5'UTR for Mitogen-activated protein kinase kinase |
ggcacgaggcctcgtgccgaattcggcacgaggga |
Yin et al. [Unpublished]. |
|
113 |
AF043384 Pleuronectes americanus |
Beta actin (ACT1) |
cgagctcgtgccgaattc ELVPNS |
J. Appl. Ichthyol. 15, 80-86. 1999; Mar Biotechnol (NY). 1, 458-0464. 1999. |
|
114 |
AY206000 Malva pusilla |
Glutathione S-transferase F1 |
aggaattcggcacgagca RNSARA |
Goodwin et al. [Unpublished]. |
|
115 |
AF499715 Thellungiella halophila |
5'UTR for Lipid transfer protein 4-like protein |
aattcggcacgaggcctcgtgccgaattcggcacgagg |
Plant Sci. 166, 609-616. 2004. |
|
116 |
AF279454 Lycopersicon esculentum |
Sesquiterpene synthase 2 (Sstle2) |
ctcgtgccgaattcggcacgagct LVPNSARA |
Plant Cell. 12, 2283-94. 2000. |
|
117 |
AF332957 Lycopersicon esculentum |
Fructose-1,6-bisphosphate aldolase |
aattcggcacgagctc NSARAQ |
Zurek and Rayle. Auxin Regulation. [Unpublished]; Plant Physiol. 104, 505-513. 1994. |
|
118 |
AY157614 Ficus carica |
5'UTR for Chitinase |
ggcacgaggcctcgtgccgaattcggcacgagg |
Plant Cell Physiol. 44, 412-414. 2003. |
|
119 |
AY089962 Solanum tuberosum |
Cysteine proteinase inhib. Prec. P7G8, Kunitz-type |
tcgtgccgaattcggcacgagtt VPNSARV |
Mol. Genet. Genomics 269, 526-534. 2003. |
|
120 |
AY098939 Solanum tuberosum |
Amino-cyclopropane-1-carboxylate oxidase (Aco) [ESTs in both sides] |
gctcgtgccgaattcggcacgagc ARAEFGTS |
J. Exp. Bot. 53, 2455-7. 2002. |
|
121 |
X93160 Spinacia oleracea |
5' UTR & 3' UTR for Ribosomal protein L4 |
aattcggcacgagctc & agctcgtgccgaattc |
J. Biol. Chem. 273, 3980-3985. 1998. |
|
122 |
AY324804 Nicotiana tabacum |
mRNA-binding protein (csp41), nuclear gene for chloroplast product |
cactcgtgccgaattcggcacgag HSCRIRHE |
Plant J. 36, 842-852. 2003; Nucleic Acids Res. 31, 4317-4325. 2003. |
|
123 |
AF242734 Capsicum annuum |
Putative proteinase inhibitor II |
cccgtgccgaattcggcacgaa PVPNSARK |
Plant Sci. 161, 727-737. 2001. |
|
124 |
AF467542 Triticum aestivum |
Gene for putative aldehyde dehydrogenase Wis1 |
gaattcggcacgagctc |
Plant Physiol. 129 (1), 169-180. 2002. |
|
125 |
M95818 & M95819 Triticum aestivum |
5'UTR for initiation factor isozyme 4F p28 subunit |
gaattcggcacgagctc |
J. Biol. Chem. 267, 23232-23236. 1992. |
|
126 |
AY387686 Triticum aestivum |
5'UTR for harpin binding protein 1 (HrBP1-1) |
gaattcggcacgagct |
Song et al. [Unpublished]. |
|
127 |
BT009402 Triticum aestivum |
mRNA for clone wlm96.pk046.j8:fis |
ctcgtgccgaattcggcacgagctcgtgccgaattcggcacgagg |
Tingey et al. [Direct Submission]. |
|
128 |
NM_188717 Oryza sativa |
Hypothetical protein |
ggcgagctcgtgccgaattag GELVPN |
The NCBI Genome Assembly Consortium [Submitted: 01-JUL-2004] |
|
129 |
AF001501 Oryza sativa |
MIRCH38 chitinase |
ggcacgagctcgtgccgaattcggcacgag GTSSCRIRHE |
Yun et al. Rice chitinase. [Unpublished]; Mol. Cells. 17, 10-6. 2004. |
|
130 |
Y12594 Oryza sativa |
Fd-GOGAT, 2 hours anaerobic coleoptiles |
gaattcggcacgagctca EFGTSS |
Mattana et al. [Unpublished, Submitted 1997] |
|
131 |
AF290415 Zea mays |
Crs1, splicing nuclear gene for chloroplast |
attcggcacgagcga IRHER |
RNA 7, 1227-1238. 2001. |
|
132 |
AF126054 & AY110620 Zea mays |
mRNA, 5'UTR for Rop3 small GTP binding protein & CL1205_2 |
gaattcggcacgagct |
Biochem. Biophys. Res. Commun. 272, 783-788. 2000; Plant Physiol. 133, 1791-808. 2003; Hainey et al. |
|
133 |
BT016274 & BT016336 Zea mays |
mRNA from Contigs [i.e., L: Starch branching enzyme II. R: Polyubiquitin] |
cctcgtgccgaattcggcacgaggcctcgtgccgaa-tcggcacgagg |
Genome Res. 14(10A): 1932-7. 2004. |
|
134 |
Y10252 Lotus corniculatus var. japonicus |
5'UTR for Pantoate-beta-alanine ligase (PanC) |
gaattcggcacgagctc |
Biochem. J. 341 (Pt 3), 669-678. 1999. |
|
135 |
AJ271664 Cicer arietinum |
Hypothetical protein, ORF, putative metallophosphatase (ppd4) |
ctcgtgccgaattcggcacgagt RAEFGTS |
Dopico et al. cDNA in chickpea epicotyls. [Unpublished]; Plant Mol Biol. 35, 433-42. 1997. |
|
136 |
AJ271659 Cicer arietinum |
Serine carboxipeptidase |
gagcggcacgagctcgtgccgac ERHELVPT |
Dopico et al. Serine carboxipeptidase in chickpea epicotyls. [Unpublished]. |
|
137 |
X88864 Medicago sativa |
5'UTR for for cyclin protein (CycMs4) |
gaattcggcacgagctc |
Plant Cell 7, 1847-1857. 1995. |
|
138 |
U14956 Vicia faba |
5'UTR for Ferredoxin NADP+ reductase precursor (fnr) |
gaattcggcacgagct |
Lax and Cary. [Unpublished]. |
|
139 |
AY220737 Hordeum vulgare |
lipoxygenase 1 protein (LOXA) |
gctcgtgccgaattcggcacgagg ARAEFGTR |
Mol. Plant Microbe Interact. 16, 893-902. 2003. |
|
140 |
AF034387 Arabidopsis thaliana |
AFT protein |
gctcgtgccgaattcggcacgagc ARAEFGTS |
Plant Physiol. 117, 1526-1526. 1998. |
|
141 |
M90510 Arabidopsis thaliana |
mRNA, 5'UTR for thaumatin-like |
ggcacgagctcgtgcaattcggccgaattcggcacgag |
Plant Cell 4, 645-656. 1992. |
|
142 |
AF001136 Pinus radiata |
5'UTR & CDS for Zinc finger protein (PrCO) |
ggcacgagctcgtgccgaattcggcacgagcgctcgtgccgaattcggcacgagctc ASCRIRHEL |
Mouradov et al. [Direct Submission]; Plant Physiol. 117, 55-62. 1998. |
|
143 |
U31309 Pinus taeda |
Chitinase homolog LP 6 (9th CDS) |
ctcgtgccgaattcggca LVPNSA |
Plant Mol Biol. 31, 693-9. 1996. |
|
144 |
AY098893 Plastid Citrus hybrid cultivar |
Plastidic ATP/ADP transporter |
gaattcggcacgagctta EFGTSL |
Planta 217, 11-20. 2003. |
|
145 |
AF195867 Vitis vinifera |
Alcohol dehydrogenase 7 (Adh7) [R: ADH6 and ADH2] |
actcgtgccgaattcggcacgagctcgtgccgaattcggcacgag TRAEFGTSCRIRHE |
Plant Physiol. 122, 619. 2000. |
|
146 |
NM_214643 & AY187547 Strongylocentrotus purpuratus |
5'UTR for heat shock protein Gp96 |
gccgaattcggcacgag |
Dev. Comp. Immunol. 27, 449-464. 2003; J. Immunol. 156, 593-602. 1996. |
|
147 |
U22507 Heliocidaris tuberculata |
5'UTR for cytoplasmic actin type III (htcyIII) |
attcggcacgagctcg |
Mol. Biol. Evol. 14, 654-665. 1997. |
|
148 |
AF015712 Dictyostelium discoideum |
Kinesin-related protein K2 |
atccgaattcggcacgag IRIRHE |
de Hostos et al. [Direct Submission]; J. Biol. Chem. 273, 793-9. 1998. |
|
149 |
AJ006788 Coprinus cinereus |
RedA |
gaattcggcacgagctca EFGTSS |
Brander KA [Unpublished]. |
|
150 |
U44431 Trametes versicolor |
5'UTR for laccase IV (lccIV) |
ggcacgagctcgtgccg |
Gene 196, 113-119 1997. |
|
Related Sequences Included for Comparison (Predicted, Genomic or Prokaryotic) |
||||
|
A |
NM_173552 & BC037293 Homo sapiens |
Predicted Hypothetical protein MGC33365 |
ttcggcacgagctggtgccgc FGTSWCR |
Nat. Genet. 36, 40-45. 2004; Proc. Natl. Acad. Sci. U.S.A. 99, 16899-16903. 2002. |
|
B |
XM_147036 Mus musculus |
Predicted RIKEN cDNA 1190002N15 |
ttcggcacgagctggtgccgt FGTSWCR |
Model Refseq, Gnomon gene prediction plus EST evidence |
|
C |
XM_236493 Rattus norvegicus |
Predicted Similar to Ab2-095 (Loc315891) |
ttcggcacgagctggtgccgc FGTSWCR |
Model Refseq, Gnomon gene prediction plus EST evidence |
|
D |
AC103936 Mus musculus |
Chromosome 9 |
ttcggcacgagctggtgccg |
Birren et al. [Direct Submission]; Nature 420, 520-62. 2002; Nat. Genet. 22, 388-93. 1999. |
|
E |
AC117379 Homo sapiens |
3 BAC RP11-392C7 (Roswell Park CIHBAC Library), complete sequence |
cggcaccagctcgtgccgaa |
Muzny et al. [Direct Submission]. |
|
F |
AL929103 & CR318657 Danio rerio |
Complete Sequence |
gctcgtgccgaattc & ctcgtgccgaattc |
Almeida J. [Direct Submission]; Barker G. [Direct Submission]. |
|
G |
AE008692 Zymomonas mobilis |
Complete Genome |
tgccgaattcggcac (plus at least 3 more smaller, to 12 b, instances) |
Nat Biotechnol. 2004 Dec 12; [Epub ahead of print]. |
|
H |
AE017172 & AE017178 Porphyromonas gingivalis |
2 Sections of the Complete Genome |
ccgaattcggcacgag (plus at least 4 more smaller, to 12 b, instances) |
J. Bacteriol. 185, 5591-5601. 2003. |
|
I |
CP000010 Burkholderia mallei |
Chromosomes, complete sequences |
acgagctcgtgccga (plus at least 50/Ch, smaller, to 12 b, instances) |
Proc. Natl. Acad. Sci. U.S.A. 101, 14247-14251. 2004. (er). |
|
J |
BX571965 & BX571966 Burkholderia pseudomallei |
Chromosomes 1 & 2, complete sequence |
ttcggcacgagctcg (plus at least 30/Ch, smaller, to 12 b, instances) |
Proc. Natl. Acad. Sci. U.S.A. 101, 14240-14245. 2004. |
|
K |
AE016994 Chlamydophila caviae |
Sections of the Complete Genome |
cggcacgagctcgtg & ttcggcacgagct |
Nucleic Acids Res. 31, 2134-2147. 2003. |
|
L |
AY307892 Uncultured Actinobacterium |
rRNA of Actinomycete |
cacgagctcgtgccg |
Piza & Manfio. Actinomycete diversity. [Unpublished]. |
|
M |
STRSTRH Streptococcus pneumoniae |
3' UTR for Beta-N-acetylhexosaminidase (strH) |
agctcgtgccgaattc |
J. Biol. Chem. 270, 8805-8814. 1995. |
|
N |
BX572599 Rhodopseudomonas palustris |
Segment of the Complete Genome |
gtgccgaattcg , gccgaattcggca , cgtgccgaattcggc |
Nat. Biotechnol. 22, 55-61. 2004. |
|
O |
AE011864 Xanthomonas axonopodis |
Section 242 of 469 of the complete genome |
Acgagctcgtgccga |
Nature 417, 459-463. 2002. |
|
P |
XM_323355 & XM_323891 Neurospora crassa |
Genome of N. crassa strain OR74A |
cgagctcgtgccgaa & cggcacaagctcgtgccga |
Nature 422, 859-868. 2003. |
* The last example-sequences (A-P), from bacteria, genomes and predicted
sequences are included for comparison purposes. Note: The actual palindromes
within the genes may be longer than the ones presented here.
This table was originally in: http://www.geocities.com/plin9k/t2.htm , now, it is at: http://www.reocities.com/plin9k/t2.htm
Additional Evidence:
Zipped Word document with examples taken from the Affymetrix Microarrays.
Zipped Excel file with examples taken from the Genbank database.
Notes:




