Personal site - Table 2 Part 2

To go to Table 2 Part 1: http://plin9k.ucoz.com/index/0-8

109	Y15794 Theileria annulata	Spm1 protein	actcgtgccgaattcggcacgagg TRAEFGTR	Mol. Biochem. Parasitol. 100, 135-140. 1999.
110	AF332963 Polytomella sp.	5'UTR for Ferrochelatase	cctcgtgccgaattcggcacgaggcctcgtgccgaattcggcacgagg	Atteia et al. [Unpublished].
111	AJ416378 Polytomella sp.	5'UTR for Cyc	ggcacgaggcctcgtgccgaattcggcacgaggga	Atteia A. [Unpublished].
112	AY093683 Suaeda maritima	5'UTR for Mitogen-activated protein kinase kinase	ggcacgaggcctcgtgccgaattcggcacgaggga	Yin et al. [Unpublished].
113	AF043384 Pleuronectes americanus	Beta actin (ACT1)	cgagctcgtgccgaattc ELVPNS	J. Appl. Ichthyol. 15, 80-86. 1999; Mar Biotechnol (NY). 1, 458-0464. 1999.
114	AY206000 Malva pusilla	Glutathione S-transferase F1	aggaattcggcacgagca RNSARA	Goodwin et al. [Unpublished].
115	AF499715 Thellungiella halophila	5'UTR for Lipid transfer protein 4-like protein	aattcggcacgaggcctcgtgccgaattcggcacgagg	Plant Sci. 166, 609-616. 2004.
116	AF279454 Lycopersicon esculentum	Sesquiterpene synthase 2 (Sstle2)	ctcgtgccgaattcggcacgagct LVPNSARA	Plant Cell. 12, 2283-94. 2000.
117	AF332957 Lycopersicon esculentum	Fructose-1,6-bisphosphate aldolase	aattcggcacgagctc NSARAQ	Zurek and Rayle. Auxin Regulation. [Unpublished]; Plant Physiol. 104, 505-513. 1994.
118	AY157614 Ficus carica	5'UTR for Chitinase	ggcacgaggcctcgtgccgaattcggcacgagg	Plant Cell Physiol. 44, 412-414. 2003.
119	AY089962 Solanum tuberosum	Cysteine proteinase inhib. Prec. P7G8, Kunitz-type	tcgtgccgaattcggcacgagtt VPNSARV	Mol. Genet. Genomics 269, 526-534. 2003.
120	AY098939 Solanum tuberosum	Amino-cyclopropane-1-carboxylate oxidase (Aco) [ESTs in both sides]	gctcgtgccgaattcggcacgagc ARAEFGTS	J. Exp. Bot. 53, 2455-7. 2002.
121	X93160 Spinacia oleracea	5' UTR & 3' UTR for Ribosomal protein L4	aattcggcacgagctc & agctcgtgccgaattc	J. Biol. Chem. 273, 3980-3985. 1998.
122	AY324804 Nicotiana tabacum	mRNA-binding protein (csp41), nuclear gene for chloroplast product	cactcgtgccgaattcggcacgag HSCRIRHE	Plant J. 36, 842-852. 2003; Nucleic Acids Res. 31, 4317-4325. 2003.
123	AF242734 Capsicum annuum	Putative proteinase inhibitor II	cccgtgccgaattcggcacgaa PVPNSARK	Plant Sci. 161, 727-737. 2001.
124	AF467542 Triticum aestivum	Gene for putative aldehyde dehydrogenase Wis1	gaattcggcacgagctc	Plant Physiol. 129 (1), 169-180. 2002.
125	M95818 & M95819 Triticum aestivum	5'UTR for initiation factor isozyme 4F p28 subunit	gaattcggcacgagctc	J. Biol. Chem. 267, 23232-23236. 1992.
126	AY387686 Triticum aestivum	5'UTR for harpin binding protein 1 (HrBP1-1)	gaattcggcacgagct	Song et al. [Unpublished].
127	BT009402 Triticum aestivum	mRNA for clone wlm96.pk046.j8:fis	ctcgtgccgaattcggcacgagctcgtgccgaattcggcacgagg	Tingey et al. [Direct Submission].
128	NM_188717 Oryza sativa	Hypothetical protein	ggcgagctcgtgccgaattag GELVPN	The NCBI Genome Assembly Consortium [Submitted: 01-JUL-2004]
129	AF001501 Oryza sativa	MIRCH38 chitinase	ggcacgagctcgtgccgaattcggcacgag GTSSCRIRHE	Yun et al. Rice chitinase. [Unpublished]; Mol. Cells. 17, 10-6. 2004.
130	Y12594 Oryza sativa	Fd-GOGAT, 2 hours anaerobic coleoptiles	gaattcggcacgagctca EFGTSS	Mattana et al. [Unpublished, Submitted 1997]
131	AF290415 Zea mays	Crs1, splicing nuclear gene for chloroplast	attcggcacgagcga IRHER	RNA 7, 1227-1238. 2001.
132	AF126054 & AY110620 Zea mays	mRNA, 5'UTR for Rop3 small GTP binding protein & CL1205_2	gaattcggcacgagct	Biochem. Biophys. Res. Commun. 272, 783-788. 2000; Plant Physiol. 133, 1791-808. 2003; Hainey et al.
133	BT016274 & BT016336 Zea mays	mRNA from Contigs [i.e., L: Starch branching enzyme II. R: Polyubiquitin]	cctcgtgccgaattcggcacgaggcctcgtgccgaa-tcggcacgagg	Genome Res. 14(10A): 1932-7. 2004.
134	Y10252 Lotus corniculatus var. japonicus	5'UTR for Pantoate-beta-alanine ligase (PanC)	gaattcggcacgagctc	Biochem. J. 341 (Pt 3), 669-678. 1999.
135	AJ271664 Cicer arietinum	Hypothetical protein, ORF, putative metallophosphatase (ppd4)	ctcgtgccgaattcggcacgagt RAEFGTS	Dopico et al. cDNA in chickpea epicotyls. [Unpublished]; Plant Mol Biol. 35, 433-42. 1997.
136	AJ271659 Cicer arietinum	Serine carboxipeptidase	gagcggcacgagctcgtgccgac ERHELVPT	Dopico et al. Serine carboxipeptidase in chickpea epicotyls. [Unpublished].
137	X88864 Medicago sativa	5'UTR for for cyclin protein (CycMs4)	gaattcggcacgagctc	Plant Cell 7, 1847-1857. 1995.
138	U14956 Vicia faba	5'UTR for Ferredoxin NADP+ reductase precursor (fnr)	gaattcggcacgagct	Lax and Cary. [Unpublished].
139	AY220737 Hordeum vulgare	lipoxygenase 1 protein (LOXA)	gctcgtgccgaattcggcacgagg ARAEFGTR	Mol. Plant Microbe Interact. 16, 893-902. 2003.
140	AF034387 Arabidopsis thaliana	AFT protein	gctcgtgccgaattcggcacgagc ARAEFGTS	Plant Physiol. 117, 1526-1526. 1998.
141	M90510 Arabidopsis thaliana	mRNA, 5'UTR for thaumatin-like	ggcacgagctcgtgcaattcggccgaattcggcacgag	Plant Cell 4, 645-656. 1992.
142	AF001136 Pinus radiata	5'UTR & CDS for Zinc finger protein (PrCO)	ggcacgagctcgtgccgaattcggcacgagcgctcgtgccgaattcggcacgagctc & gc ASCRIRHEL	Mouradov et al. [Direct Submission]; Plant Physiol. 117, 55-62. 1998.
143	U31309 Pinus taeda	Chitinase homolog LP 6 (9^th CDS)	ctcgtgccgaattcggca LVPNSA	Plant Mol Biol. 31, 693-9. 1996.
144	AY098893 Plastid Citrus hybrid cultivar	Plastidic ATP/ADP transporter	gaattcggcacgagctta EFGTSL	Planta 217, 11-20. 2003.
145	AF195867 Vitis vinifera	Alcohol dehydrogenase 7 (Adh7) [R: ADH6 and ADH2]	actcgtgccgaattcggcacgagctcgtgccgaattcggcacgag TRAEFGTSCRIRHE	Plant Physiol. 122, 619. 2000.
146	NM_214643 & AY187547 Strongylocentrotus purpuratus	5'UTR for heat shock protein Gp96	gccgaattcggcacgag	Dev. Comp. Immunol. 27, 449-464. 2003; J. Immunol. 156, 593-602. 1996.
147	U22507 Heliocidaris tuberculata	5'UTR for cytoplasmic actin type III (htcyIII)	attcggcacgagctcg	Mol. Biol. Evol. 14, 654-665. 1997.
148	AF015712 Dictyostelium discoideum	Kinesin-related protein K2	atccgaattcggcacgag IRIRHE	de Hostos et al. [Direct Submission]; J. Biol. Chem. 273, 793-9. 1998.
149	AJ006788 Coprinus cinereus	RedA	gaattcggcacgagctca EFGTSS	Brander KA [Unpublished].
150	U44431 Trametes versicolor	5'UTR for laccase IV (lccIV)	ggcacgagctcgtgccg	Gene 196, 113-119 1997.
Related Sequences Included for Comparison (Predicted, Genomic or Prokaryotic)
A	NM_173552 & BC037293 Homo sapiens	Predicted Hypothetical protein MGC33365	ttcggcacgagctggtgccgc FGTSWCR	Nat. Genet. 36, 40-45. 2004; Proc. Natl. Acad. Sci. U.S.A. 99, 16899-16903. 2002.
B	XM_147036 Mus musculus	Predicted RIKEN cDNA 1190002N15	ttcggcacgagctggtgccgt FGTSWCR	Model Refseq, Gnomon gene prediction plus EST evidence
C	XM_236493 Rattus norvegicus	Predicted Similar to Ab2-095 (Loc315891)	ttcggcacgagctggtgccgc FGTSWCR	Model Refseq, Gnomon gene prediction plus EST evidence
D	AC103936 Mus musculus	Chromosome 9	ttcggcacgagctggtgccg	Birren et al. [Direct Submission]; Nature 420, 520-62. 2002; Nat. Genet. 22, 388-93. 1999.
E	AC117379 Homo sapiens	3 BAC RP11-392C7 (Roswell Park CIHBAC Library), complete sequence	cggcaccagctcgtgccgaa	Muzny et al. [Direct Submission].
F	AL929103 & CR318657 Danio rerio	Complete Sequence	gctcgtgccgaattc & ctcgtgccgaattc	Almeida J. [Direct Submission]; Barker G. [Direct Submission].
G	AE008692 Zymomonas mobilis	Complete Genome	tgccgaattcggcac (plus at least 3 more smaller, to 12 b, instances)	Nat Biotechnol. 2004 Dec 12; [Epub ahead of print].
H	AE017172 & AE017178 Porphyromonas gingivalis	2 Sections of the Complete Genome	ccgaattcggcacgag (plus at least 4 more smaller, to 12 b, instances)	J. Bacteriol. 185, 5591-5601. 2003.
I	CP000010 Burkholderia mallei	Chromosomes, complete sequences	acgagctcgtgccga (plus at least 50/Ch, smaller, to 12 b, instances)	Proc. Natl. Acad. Sci. U.S.A. 101, 14247-14251. 2004. (er).
J	BX571965 & BX571966 Burkholderia pseudomallei	Chromosomes 1 & 2, complete sequence	ttcggcacgagctcg (plus at least 30/Ch, smaller, to 12 b, instances)	Proc. Natl. Acad. Sci. U.S.A. 101, 14240-14245. 2004.
K	AE016994 Chlamydophila caviae	Sections of the Complete Genome	cggcacgagctcgtg & ttcggcacgagct	Nucleic Acids Res. 31, 2134-2147. 2003.
L	AY307892 Uncultured Actinobacterium	rRNA of Actinomycete	cacgagctcgtgccg	Piza & Manfio. Actinomycete diversity. [Unpublished].
M	STRSTRH Streptococcus pneumoniae	3' UTR for Beta-N-acetylhexosaminidase (strH)	agctcgtgccgaattc	J. Biol. Chem. 270, 8805-8814. 1995.
N	BX572599 Rhodopseudomonas palustris	Segment of the Complete Genome	gtgccgaattcg , gccgaattcggca , cgtgccgaattcggc	Nat. Biotechnol. 22, 55-61. 2004.
O	AE011864 Xanthomonas axonopodis	Section 242 of 469 of the complete genome	Acgagctcgtgccga	Nature 417, 459-463. 2002.
P	XM_323355 & XM_323891 Neurospora crassa	Genome of N. crassa strain OR74A	cgagctcgtgccgaa & cggcacaagctcgtgccga	Nature 422, 859-868. 2003.

* The last example-sequences (A-P), from bacteria, genomes and predicted sequences are included for comparison purposes. Note: The actual palindromes within the genes may be longer than the ones presented here.

This table was originally in: http://www.geocities.com/plin9k/t2.htm , now, it is at: http://www.reocities.com/plin9k/t2.htm

Additional Evidence:

Zipped Word document with examples taken from the Affymetrix Microarrays.

Zipped Excel file with examples taken from the Genbank database.

Notes:

The Original Article in PDF is at the International Society for Complexity, Information and Design (ISCID).

Original Article in HTM.

		Monday, 12.23.2024
	My site